surf6

Ensembl ID:
ENSDARG00000035427
ZFIN ID:
ZDB-GENE-040426-1333
Description:
surfeit locus protein 6 [Source:RefSeq peptide;Acc:NP_957359]
Human Orthologue:
SURF6
Human Description:
surfeit 6 [Source:HGNC Symbol;Acc:11478]
Mouse Orthologue:
Surf6
Mouse Description:
surfeit gene 6 Gene [Source:MGI Symbol;Acc:MGI:98447]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20466 Nonsense Available for shipment Available now
sa25303 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051344 Nonsense 95 362 3 5
ENSDART00000138116 Nonsense 95 362 3 5
Genomic Location (Zv9):
Chromosome 5 (position 34895732)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32677681
GRCz11 5 33277834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACACCTCCAGCTCAAAGGAAAACTGTCCAAAACGGGACTTCAGTAACA[C/T]AAAACAAGCCTGGAGGTAAAAAAGCAATTTGTATAGAGAGAGAGTATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051344 Essential Splice Site 127 362 None 5
ENSDART00000138116 Essential Splice Site 127 362 None 5
Genomic Location (Zv9):
Chromosome 5 (position 34893897)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32675846
GRCz11 5 33275999
KASP Assay ID:
554-7317.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATATTTCAAGCCAATCATTTTAAAGTCAATTATATGAATGTTTTTCC[A/C]GGGCACGCCGAAAGATCCCTCCTCTGATGAGGTCAAGATGAAACGGGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link