
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000035366
- Ensembl ID:
- ENSDARG00000035366
- Human Orthologue:
- CLASP1
- Human Description:
- cytoplasmic linker associated protein 1 [Source:HGNC Symbol;Acc:17088]
- Mouse Orthologue:
- Clasp1
- Mouse Description:
- CLIP associating protein 1 Gene [Source:MGI Symbol;Acc:MGI:1923957]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35164 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35164
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051242 | Nonsense | 41 | 94 | 2 | 3 |
- Genomic Location (Zv9):
- Chromosome 11 (position 45205684)
- Other Location(s):
-
Assembly Chromosome Position GRCz11 11 44124679 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTTTTCCCAGTTCTGCCCAGTTTAATGGACCGTTTAGGTGATTCTAAA[G/T]AGCAAGTTCGAGATCAGGCGCAGTCACTTCTGCTGAAAATGATGGATCAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: