zgc:194261

Ensembl ID:
ENSDARG00000035340
ZFIN ID:
ZDB-GENE-080723-77
Description:
connexin 35-like [Source:RefSeq peptide;Acc:NP_001122238]
Human Orthologue:
GJD2
Human Description:
gap junction protein, delta 2, 36kDa [Source:HGNC Symbol;Acc:19154]
Mouse Orthologue:
Gjd2
Mouse Description:
gap junction protein, delta 2 Gene [Source:MGI Symbol;Acc:MGI:1334209]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40501 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040537 Nonsense 176 299 2 2
Genomic Location (Zv9):
Chromosome 5 (position 38596999)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36396683
GRCz11 5 36996836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTCCAAAAGTGCCAAGATCCGCCAGCAGGAAGGCATCTCCCGCTTCTA[T/A]GTCATCCAAGTGGTGTTCCGGAACGTTCTGGAAATCGGCTTTCTAGCCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: A genome-wide association study identifies a susceptibility locus for refractive errors and myopia at 15q14. (View Study)
  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link