zgc:92773

Ensembl ID:
ENSDARG00000035215
ZFIN ID:
ZDB-GENE-040718-292
Description:
diamine N-acetyltransferase 2 [Source:RefSeq peptide;Acc:NP_001002554]
Human Orthologue:
SAT2
Human Description:
spermidine/spermine N1-acetyltransferase family member 2 [Source:HGNC Symbol;Acc:23160]
Mouse Orthologue:
Sat2
Mouse Description:
spermidine/spermine N1-acetyl transferase 2 Gene [Source:MGI Symbol;Acc:MGI:1916465]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20557 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132548 Essential Splice Site 67 171 None 6

The following transcripts of ENSDARG00000035215 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 63622279)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 53178897
GRCz11 5 53825490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCATTGTCTTGTAGCTGAGGTACCTGAGGAGCACAAGTCTAAAGATGG[T/A]ATGACCCTTAAAAAAACAAAATTAATAGCGTCATAAACCCTTACCTTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Testosterone levels: Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link