si:dkey-47k20.8

Ensembl ID:
ENSDARG00000035214
ZFIN ID:
ZDB-GENE-060503-359
Description:
Novel protein similar to vertebrate pheromone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3QJY5]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36688 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040661 Essential Splice Site 516 849 5 7
ENSDART00000140043 Essential Splice Site 503 848 4 6
Genomic Location (Zv9):
Chromosome 18 (position 31906545)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33703404
GRCz11 18 33677999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCACACTGGATGCAGATGCAATATATTGGAACTTTGAAACCAAAAAA[G/A]TAACTAACCTTGTCTGTTCGTAACCCTTTTCAAAGATCAGAATTTTAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link