slc25a46

Ensembl ID:
ENSDARG00000035181
ZFIN ID:
ZDB-GENE-040718-296
Description:
Solute carrier family 25 member 46 [Source:UniProtKB/Swiss-Prot;Acc:Q6DGU5]
Human Orthologue:
SLC25A46
Human Description:
solute carrier family 25, member 46 [Source:HGNC Symbol;Acc:25198]
Mouse Orthologue:
Slc25a46
Mouse Description:
solute carrier family 25, member 46 Gene [Source:MGI Symbol;Acc:MGI:1914703]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38509 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050966 Nonsense 182 405 6 8
Genomic Location (Zv9):
Chromosome 5 (position 57337319)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55257918
GRCz11 5 55928135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTTAATTGTATCTTCACAGGGAGTTATCACACAAGTGGAACCCTAAA[C/T]AAGTTGTGGGACACTTAGTACTCAAAGGGTAAGTTAAGAGTTTTGCCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link