
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ap2b1
- Ensembl ID:
- ENSDARG00000035152
- ZFIN ID:
- ZDB-GENE-030131-6564
- Description:
- AP-2 complex subunit beta [Source:RefSeq peptide;Acc:NP_956213]
- Human Orthologue:
- AP2B1
- Human Description:
- adaptor-related protein complex 2, beta 1 subunit [Source:HGNC Symbol;Acc:563]
- Mouse Orthologue:
- Ap2b1
- Mouse Description:
- adaptor-related protein complex 2, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:1919020]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14392 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14392
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050916 | Nonsense | 400 | 951 | 10 | 22 |
ENSDART00000134387 | Nonsense | 400 | 598 | 10 | 13 |
- Genomic Location (Zv9):
- Chromosome 5 (position 64737657)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 60990317 GRCz11 5 61675038 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTTCTAGCAATCCGCTGAGCGCTGTGTTAGCACCCTGCTGGACCTTATC[C/T]AGACCAAAGTCAACTACGTCGTGCAGGAAGCCATTGTGGTCATCAGGGAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: