si:dkey-261j4.4

Ensembl ID:
ENSDARG00000035150
ZFIN ID:
ZDB-GENE-060531-125
Description:
hypothetical protein LOC555524 [Source:RefSeq peptide;Acc:NP_001159918]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20563 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050914 Nonsense 126 411 3 3
ENSDART00000141323 Nonsense 126 411 3 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 64679574)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60932234
GRCz11 5 61616955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCACATGACACTCCACCCTAAATACAAGCCGTACAAATGTGATCAATGC[G/T]AGAAGAGTTACGGGCGAGAAGACCACCTTCAGAGACACATGAAGCTTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link