si:dkey-261j4.7

Ensembl ID:
ENSDARG00000035148
ZFIN ID:
ZDB-GENE-060531-127
Description:
hypothetical protein LOC555612 [Source:RefSeq peptide;Acc:NP_001159919]
Human Orthologue:
ORAI2
Human Description:
ORAI calcium release-activated calcium modulator 2 [Source:HGNC Symbol;Acc:21667]
Mouse Orthologues:
AC154854.1, Orai2
Mouse Descriptions:
ORAI calcium release-activated calcium modulator 2 Gene [Source:MGI Symbol;Acc:MGI:2443195]
predicted gene 4659 (Gm4659), mRNA [Source:RefSeq DNA;Acc:NM_001111287]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20562 Nonsense Available for shipment Available now
sa40583 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050910 Nonsense 21 267 1 2
ENSDART00000131937 Nonsense 21 267 2 3
Genomic Location (Zv9):
Chromosome 5 (position 64629301)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60881961
GRCz11 5 61566682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCACAGTGCCAATGGGCTCTCCAGCTCCCGGCGGCTCAGACCGGCTG[C/T]AGGATGGCGGTGGGATGGACTACAGGGACTGGGTTCGGCGCAGTTATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050910 Nonsense 234 267 2 2
ENSDART00000131937 Nonsense 234 267 3 3
Genomic Location (Zv9):
Chromosome 5 (position 64633963)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60886623
GRCz11 5 61571344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGCCGGTGGGATTGATCTTTGTGGTGTTCACCATTCACTTCTACCGTT[C/A]ACTAGTGCGGCACAAAACAGAGCGCCACCATCAGGAGATCGAGGAACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link