zgc:101858

Ensembl ID:
ENSDARG00000035129
ZFIN ID:
ZDB-GENE-040927-13
Description:
hypothetical protein LOC449555 [Source:RefSeq peptide;Acc:NP_001005597]
Human Orthologue:
DCXR
Human Description:
dicarbonyl/L-xylulose reductase [Source:HGNC Symbol;Acc:18985]
Mouse Orthologues:
Cbr2, Dcxr
Mouse Descriptions:
carbonyl reductase 2 Gene [Source:MGI Symbol;Acc:MGI:107200]
dicarbonyl L-xylulose reductase Gene [Source:MGI Symbol;Acc:MGI:1915130]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33752 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050863 Essential Splice Site 8 265 1 8
ENSDART00000050863 Essential Splice Site 8 265 1 8
Genomic Location (Zv9):
Chromosome 5 (position 68434259)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64175759
GRCz11 5 64856923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGCGAACTCAGAACTCATCATAATGGCAGCTCCTGATGCTTTTAAAG[T/A]AGGTTTGAGGCTCTTACACAAACAGCATTTCATTTGCAAGCTGAAAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link