zgc:113114

Ensembl ID:
ENSDARG00000035074
ZFIN ID:
ZDB-GENE-050306-11
Description:
Regulator of telomere elongation helicase 1 [Source:UniProtKB/Swiss-Prot;Acc:P0C928]
Mouse Orthologue:
Rtel1
Mouse Description:
regulator of telomere elongation helicase 1 Gene [Source:MGI Symbol;Acc:MGI:2139369]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10862 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066122   None 443 None 11
ENSDART00000104127   None 442 None 12
ENSDART00000123445 Nonsense 119 1177 3 33
Genomic Location (Zv9):
Chromosome 11 (position 12874016)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12758425
GRCz11 11 12816084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATACTGACATTCCCAAGATCATATATGCCTCCAGGACTCATTCGCAGT[T/A]AACACAAGTTGTAAATGAGCTGAAGAATACATCATACAGGTCAGTCAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link