ubtf

Ensembl ID:
ENSDARG00000035066
ZFIN ID:
ZDB-GENE-030616-252
Description:
upstream binding transcription factor, RNA polymerase I [Source:RefSeq peptide;Acc:NP_001005395]
Human Orthologue:
UBTF
Human Description:
upstream binding transcription factor, RNA polymerase I [Source:HGNC Symbol;Acc:12511]
Mouse Orthologues:
Ubtf, Ubtfl1
Mouse Descriptions:
upstream binding transcription factor, RNA polymerase I Gene [Source:MGI Symbol;Acc:MGI:98512]
upstream binding transcription factor, RNA polymerase I-like 1 Gene [Source:MGI Symbol;Acc:MGI:35882

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25244 Nonsense Mutation detected in F1 DNA During 2018
sa33145 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056614 Nonsense 339 735 11 22
ENSDART00000126915 Nonsense 339 447 10 13
Genomic Location (Zv9):
Chromosome 3 (position 19940448)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19901423
GRCz11 3 20051163
KASP Assay ID:
554-7693.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGCGCTGGAAACTCCTCAAACAGGCCGAGAAAGACGCATACCAAAAG[C/T]GATGTGAACAGGTCTGTAATGCACTCATTCAAACAGTGCTTTTATTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056614 Nonsense 556 735 17 22
ENSDART00000126915   None 447 None 13
Genomic Location (Zv9):
Chromosome 3 (position 19937254)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19898229
GRCz11 3 20047969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCCCTGCCCCAGTGATAACCCCTGGGAAAAAGATGAAATTTGACGGC[G/T]AACCTAAGAAACCACCCTCGTAAGTTTATTCAGTGTGTGTGTGCAAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link