
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
retsatl
- Ensembl ID:
- ENSDARG00000034989
- ZFIN ID:
- ZDB-GENE-051113-252
- Description:
- retinol saturase-like [Source:RefSeq peptide;Acc:NP_001035093]
- Human Orthologue:
- RETSAT
- Human Description:
- retinol saturase (all-trans-retinol 13,14-reductase) [Source:HGNC Symbol;Acc:25991]
- Mouse Orthologue:
- Retsat
- Mouse Description:
- retinol saturase (all trans retinol 13,14 reductase) Gene [Source:MGI Symbol;Acc:MGI:1914692]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11225 | Nonsense | Available for shipment | Available now |
sa10711 | Nonsense | Available for shipment | Available now |
sa21592 | Nonsense | Available for shipment | Available now |
sa21593 | Nonsense | Available for shipment | Available now |
sa21594 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11225
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043899 | Nonsense | 3 | 607 | 1 | 11 |
ENSDART00000141434 | Nonsense | 3 | 604 | 1 | 11 |
The following transcripts of ENSDARG00000034989 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 46061767)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 45193432 GRCz11 9 44994384 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCTCAAATTCAAAGTTACAGNYYTTTTCTGCCAKTGATTGAAGATGTGGTG[G/A]MTTTTGYTGTTCTTAGAATGGTTTGTAGACTGGGCTCRYGGCACATTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10711
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043899 | Nonsense | 231 | 607 | 4 | 11 |
ENSDART00000141434 | Nonsense | 231 | 604 | 4 | 11 |
The following transcripts of ENSDARG00000034989 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 46063328)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 45194993 GRCz11 9 44995945 - KASP Assay ID:
- 2260-2473.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCTCGCTTYATATTGAGGACTGGAATTGCTGACTTTATTTCCCCAATTT[T/A]AAAATAYTCCCGCACCAGTACATCAGAGGTGGTCAAGTCTCTYACCAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21592
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043899 | Nonsense | 288 | 607 | 5 | 11 |
ENSDART00000141434 | Nonsense | 285 | 604 | 5 | 11 |
The following transcripts of ENSDARG00000034989 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 46063598)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 45195263 GRCz11 9 44996215 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCATGATTGATGCCCTCCTCCTACACCACTCAAAGCGTGGTGTGTACTA[T/A]CCTCAGGGTGGTGCTAGTGAAATCCCGTATCATATCATCCAGGTTTTGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21593
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043899 | Nonsense | 386 | 607 | 7 | 11 |
ENSDART00000141434 | Nonsense | 383 | 604 | 7 | 11 |
The following transcripts of ENSDARG00000034989 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 46064276)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 45195941 GRCz11 9 44996893 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGAGGTCCAGGAATATCTTAAAGCTCTGAAACCAGGCAAAGGCTTTTTT[C/T]AAGTATTTGCTGGCTTCAATGCCACAATGGAAGAACTAGGCATCTCTTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21594
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043899 | Essential Splice Site | 416 | 607 | None | 11 |
ENSDART00000141434 | Essential Splice Site | 413 | 604 | None | 11 |
The following transcripts of ENSDARG00000034989 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 46064446)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 45196111 GRCz11 9 44997063 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGCTATCTATTCTTCCTGCTAGTTCTTACTTTATTTTTCCGTTCCCTGT[A/G]GGATGGAGGAGTACTTTGCTTCAGACAAGCAAGATGCACCTGATAATGTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: