zcchc8

Ensembl ID:
ENSDARG00000034982
ZFIN ID:
ZDB-GENE-060526-6
Description:
zinc finger CCHC domain-containing protein 8 [Source:RefSeq peptide;Acc:NP_001077287]
Human Orthologue:
ZCCHC8
Human Description:
zinc finger, CCHC domain containing 8 [Source:HGNC Symbol;Acc:25265]
Mouse Orthologue:
Zcchc8
Mouse Description:
zinc finger, CCHC domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1917900]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11152 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125781 Nonsense 312 691 10 14
ENSDART00000125874 Nonsense 312 410 10 13

The following transcripts of ENSDARG00000034982 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70257101)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66582245
GRCz11 5 67260614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCATGAGGGAGCTCGGTTACCCGCCTGGATGGCTCAAAGAGGCAGAAT[T/A]GGAAAACTCAGGCCTGATGCTTTATGATGGTAAGAGATTCACAAGGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link