si:dkey-224e22.2

Ensembl ID:
ENSDARG00000034941
ZFIN ID:
ZDB-GENE-061207-59
Description:
Beta-galactosidase [Source:UniProtKB/TrEMBL;Acc:A2BIK1]
Human Orthologues:
GLB1L2, GLB1L3
Human Descriptions:
galactosidase, beta 1-like 2 [Source:HGNC Symbol;Acc:25129]
galactosidase, beta 1-like 3 [Source:HGNC Symbol;Acc:25147]
Mouse Orthologues:
Glb1l2, Glb1l3, Gm1110
Mouse Descriptions:
galactosidase, beta 1 like 3 Gene [Source:MGI Symbol;Acc:MGI:1918143]
galactosidase, beta 1-like 2 Gene [Source:MGI Symbol;Acc:MGI:2388283]
predicted gene 1110 Gene [Source:MGI Symbol;Acc:MGI:2685956]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6534 Nonsense Mutation detected in F1 DNA During 2018
sa36723 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6534
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098523 Nonsense 68 633 3 20
ENSDART00000132775 Nonsense 30 222 1 7
ENSDART00000139690 Nonsense 30 603 2 19
Genomic Location (Zv9):
Chromosome 18 (position 43166919)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44756810
GRCz11 18 44750264
KASP Assay ID:
554-5216.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACTTTAGCAGGAGCTCCGTTTCGGATCTTGGGAGGCTYCATCCACTA[T/A]TTTCGGGTGCCCAGGGCCCACTGGAGAGATCGGCTGCTGAAACTGAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098523 Essential Splice Site 338 633 11 20
ENSDART00000132775   None 222 None 7
ENSDART00000139690 Essential Splice Site 300 603 10 19
Genomic Location (Zv9):
Chromosome 18 (position 43173974)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44763865
GRCz11 18 44757319
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGGAGCAGTTGATTTGGGCACCTACAAACCACAGACAAGCAGCTATG[G/C]TTAGTAGTTTTAATAATCATGCCCACATGAAAAATAAGAATAGTAGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link