slc1a7a

Ensembl ID:
ENSDARG00000034940
ZFIN ID:
ZDB-GENE-061009-24
Description:
solute carrier family 1 (glutamate transporter), member 7a [Source:RefSeq peptide;Acc:NP_001124094]
Human Orthologue:
SLC1A7
Human Description:
solute carrier family 1 (glutamate transporter), member 7 [Source:HGNC Symbol;Acc:10945]
Mouse Orthologue:
Slc1a7
Mouse Description:
solute carrier family 1 (glutamate transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:2444087]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17750 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063269 Essential Splice Site 343 513 7 9
ENSDART00000124324 Essential Splice Site 412 582 9 11
Genomic Location (Zv9):
Chromosome 2 (position 5639335)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 6085063
GRCz11 2 5996945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATTGCCGTTGATATATCCCATATTTATACATACTTTTATTCTTACTT[A/C]GCATYACAGCGACAGCAGCCAGTATCGGTGCTGCTGGCATTCCGCAGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link