zgc:162618

Ensembl ID:
ENSDARG00000034933
ZFIN ID:
ZDB-GENE-030131-4476
Description:
hypothetical protein LOC325751 [Source:RefSeq peptide;Acc:NP_001082800]
Human Orthologue:
CHCHD3
Human Description:
coiled-coil-helix-coiled-coil-helix domain containing 3 [Source:HGNC Symbol;Acc:21906]
Mouse Orthologue:
Chchd3
Mouse Description:
coiled-coil-helix-coiled-coil-helix domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1913325]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13069 Nonsense Available for shipment Available now
sa17229 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104877 Nonsense 399 449 8 9

The following transcripts of ENSDARG00000034933 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 3422966)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3241161
GRCz11 25 3366905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTCAAGCATTCAACAGAGACTTTTTTGTTCACTCTCTGTAGGCGATAT[C/T]GAATCAAGCCYGTGTGTTCAGATCTCCAGAGTCAGATCTTGAAGTGTWAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104877 Nonsense 444 449 9 9

The following transcripts of ENSDARG00000034933 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 3424830)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3243025
GRCz11 25 3368769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYTTTGCTGAATTATTTACAGATTTGTTGTATTTATTGTTTCAGGATGAA[A/T]AGTTGAGCACTGGAGGTTGAGTTACCGSCCTGAACAKGAGANNAAAAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link