wnt5b

Ensembl ID:
ENSDARG00000034894
ZFIN ID:
ZDB-GENE-980526-87
Description:
Protein Wnt-5b [Source:UniProtKB/Swiss-Prot;Acc:Q92050]
Human Orthologues:
WNT5A, WNT5B
Human Descriptions:
wingless-type MMTV integration site family, member 5A [Source:HGNC Symbol;Acc:12784]
wingless-type MMTV integration site family, member 5B [Source:HGNC Symbol;Acc:16265]
Mouse Orthologues:
Wnt5a, Wnt5b
Mouse Descriptions:
wingless-related MMTV integration site 5A Gene [Source:MGI Symbol;Acc:MGI:98958]
wingless-related MMTV integration site 5B Gene [Source:MGI Symbol;Acc:MGI:98959]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33385 Nonsense Mutation detected in F1 DNA During 2018
sa45164 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041852 Nonsense 78 363 4 6
ENSDART00000074651 Nonsense 78 363 5 7
ENSDART00000122986 Nonsense 95 380 2 4
Genomic Location (Zv9):
Chromosome 4 (position 7518811)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 8639725
GRCz11 4 8640641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGAGGAAGCTCTGCCAGCTCTATCAGGACCACATGGTTTATATTGGA[G/T]AGGGGGCGAAGACGGGCATCAAAGAGTGCCAGTATCAGTTCAGACAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041852 Essential Splice Site 211 363 5 6
ENSDART00000074651 Essential Splice Site 211 363 6 7
ENSDART00000122986 Essential Splice Site 228 380 3 4
Genomic Location (Zv9):
Chromosome 4 (position 7513473)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 8645165
GRCz11 4 8646081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACGCACGCACGCTTATGAATCTGCAGAACAATGAAGCCGGAAGAATG[G/A]TGAGGAAATAAACACACACATCAGTGATCTGCTTTCTTATTTTTGGCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link