
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
wnt5b
- Ensembl ID:
- ENSDARG00000034894
- ZFIN ID:
- ZDB-GENE-980526-87
- Description:
- Protein Wnt-5b [Source:UniProtKB/Swiss-Prot;Acc:Q92050]
- Human Orthologues:
- WNT5A, WNT5B
- Human Descriptions:
- wingless-type MMTV integration site family, member 5A [Source:HGNC Symbol;Acc:12784]
- wingless-type MMTV integration site family, member 5B [Source:HGNC Symbol;Acc:16265]
- Mouse Orthologues:
- Wnt5a, Wnt5b
- Mouse Descriptions:
- wingless-related MMTV integration site 5A Gene [Source:MGI Symbol;Acc:MGI:98958]
- wingless-related MMTV integration site 5B Gene [Source:MGI Symbol;Acc:MGI:98959]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33385 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa45164 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33385
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041852 | Nonsense | 78 | 363 | 4 | 6 |
ENSDART00000074651 | Nonsense | 78 | 363 | 5 | 7 |
ENSDART00000122986 | Nonsense | 95 | 380 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 4 (position 7518811)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 8639725 GRCz11 4 8640641 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCAGAGGAAGCTCTGCCAGCTCTATCAGGACCACATGGTTTATATTGGA[G/T]AGGGGGCGAAGACGGGCATCAAAGAGTGCCAGTATCAGTTCAGACAGAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45164
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041852 | Essential Splice Site | 211 | 363 | 5 | 6 |
ENSDART00000074651 | Essential Splice Site | 211 | 363 | 6 | 7 |
ENSDART00000122986 | Essential Splice Site | 228 | 380 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 4 (position 7513473)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 8645165 GRCz11 4 8646081 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACACGCACGCACGCTTATGAATCTGCAGAACAATGAAGCCGGAAGAATG[G/A]TGAGGAAATAAACACACACATCAGTGATCTGCTTTCTTATTTTTGGCTGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: