acbd5a

Ensembl ID:
ENSDARG00000034883
ZFIN ID:
ZDB-GENE-050522-268
Description:
Acyl-CoA-binding domain-containing protein 5A [Source:UniProtKB/Swiss-Prot;Acc:Q502L1]
Human Orthologue:
ACBD5
Human Description:
acyl-CoA binding domain containing 5 [Source:HGNC Symbol;Acc:23338]
Mouse Orthologue:
Acbd5
Mouse Description:
acyl-Coenzyme A binding domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1921409]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39434 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007373 Essential Splice Site 27 501 None 13
ENSDART00000122018 Essential Splice Site 28 502 None 13
ENSDART00000135124 Essential Splice Site 28 503 None 13
ENSDART00000138412 Essential Splice Site 28 77 None 3
Genomic Location (Zv9):
Chromosome 24 (position 6015971)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5903263
GRCz11 24 5932592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGGTTCAACGCTGCTGTCAAAGTCATCCAGAATTTACCATCAAACGG[T/C]GAGTACTGATTGGTCAGCCTTTTAGGCAGTTTGTTATTGTGTGTTGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link