zdhhc2

Ensembl ID:
ENSDARG00000034757
ZFIN ID:
ZDB-GENE-050320-58
Description:
palmitoyltransferase ZDHHC2 [Source:RefSeq peptide;Acc:NP_001013510]
Human Orthologue:
ZDHHC2
Human Description:
zinc finger, DHHC-type containing 2 [Source:HGNC Symbol;Acc:18469]
Mouse Orthologue:
Zdhhc2
Mouse Description:
zinc finger, DHHC domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1923452]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42405 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011480 Essential Splice Site 122 361 5 13
Genomic Location (Zv9):
Chromosome 14 (position 31310790)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30100847
GRCz11 14 30441161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCAGCCAATGCTATCGATCTGTATTTTTAACAAGCTGTCTTGATACA[G/A]CAATCCGCTACTGTGATCGCTGTCTGCTGCTGAAGCCTGATCGATGCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link