
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
esyt1a
- Ensembl ID:
- ENSDARG00000034714
- ZFIN ID:
- ZDB-GENE-090311-55
- Human Orthologue:
- ESYT1
- Human Description:
- extended synaptotagmin-like protein 1 [Source:HGNC Symbol;Acc:29534]
- Mouse Orthologue:
- Esyt1
- Mouse Description:
- extended synaptotagmin-like protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344426]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24338 | Nonsense | Available for shipment | Available now |
sa24339 | Essential Splice Site | Available for shipment | Available now |
sa43987 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa43988 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11243 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24338
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032290 | Nonsense | 72 | 1079 | 1 | 31 |
ENSDART00000140463 | Nonsense | 72 | 901 | 1 | 25 |
- Genomic Location (Zv9):
- Chromosome 23 (position 25595721)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 25381841 GRCz11 23 25308382 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGTTATTTCGGCTTCAGTATCAGTGTAGTTCTGCTCGGGCTCCTGGTTTA[T/A]ATAGGATGGAAACACAGTCGCGATGGGAAAAAAGCGCGACTGCAGAGCGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24339
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032290 | Essential Splice Site | 173 | 1079 | 3 | 31 |
ENSDART00000140463 | Essential Splice Site | 173 | 901 | 3 | 25 |
- Genomic Location (Zv9):
- Chromosome 23 (position 25602656)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 25388776 GRCz11 23 25315317 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCTCATCTGCAGACTCTAAGCTTCACTAAAGTTGACTTGGGTGACAGGG[T/C]AAACAAATTCGTTTGTGATCATCATAGAAAGACTTTATTTGCATATGTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43987
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032290 | Essential Splice Site | 271 | 1079 | 8 | 31 |
ENSDART00000140463 | Essential Splice Site | 271 | 901 | 8 | 25 |
- Genomic Location (Zv9):
- Chromosome 23 (position 25605787)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 25391907 GRCz11 23 25318448 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGCCTCTGTGTCCCATTTTTTCTGTACGAACCCCTTGCATTCATTTCC[A/T]GTGCCATGTCGGACACTATGATAATGGATGCAATCGCCTCTTTCCTGGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43988
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032290 | Nonsense | 760 | 1079 | 21 | 31 |
ENSDART00000140463 | Nonsense | 760 | 901 | 21 | 25 |
- Genomic Location (Zv9):
- Chromosome 23 (position 25626309)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 25412429 GRCz11 23 25338970 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGAAGACCGGAAGAATCCATCTGGTGTTAGAATGGGTGCCTAAAATTT[C/A]AGATCCCATCAGACTTGAACAGGTCATATCCTGTTTCTGAAAATGTTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11243
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032290 | Essential Splice Site | 1019 | 1079 | 28 | 31 |
ENSDART00000140463 | None | 901 | None | 25 |
- Genomic Location (Zv9):
- Chromosome 23 (position 25630643)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 25416763 GRCz11 23 25343304 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGAAGACCAGTGTTAAAAAGAAAAGCCTCAAACCAGAGTTCAATGAGAT[G/A]TTAGTAGGAACRTTCATAAATYACTGTCTTTGNNCACAAGAGTGGAAGTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Systemic sclerosis: Identification of novel genetic markers associated with clinical phenotypes of systemic sclerosis through a genome-wide association strategy. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: