slc1a8a

Ensembl ID:
ENSDARG00000034628
ZFIN ID:
ZDB-GENE-101111-8
Description:
Excitatory amino acid transporter SLC1A8a [Source:UniProtKB/TrEMBL;Acc:D7RVS6]
Human Orthologue:
SLC1A7
Human Description:
solute carrier family 1 (glutamate transporter), member 7 [Source:HGNC Symbol;Acc:10945]
Mouse Orthologue:
Slc1a7
Mouse Description:
solute carrier family 1 (glutamate transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:2444087]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16033 Nonsense Available for shipment Available now
sa16384 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040105 Nonsense 417 598 8 11
ENSDART00000040105 Nonsense 417 598 8 11
Genomic Location (Zv9):
Chromosome 11 (position 15231713)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15013294
GRCz11 11 15070953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGTTCAGCAACACTTCCCATTACAAYGAAATGTTTRTTGGAGAACTG[T/A]CGAGTGGACAGGCAGWTTGCTCGATTTGTGCTGCCAGTGGGAGCAACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040105 Nonsense 417 598 8 11
ENSDART00000040105 Nonsense 417 598 8 11
Genomic Location (Zv9):
Chromosome 11 (position 15231713)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15013294
GRCz11 11 15070953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGTTCAGCAACACTTCCCATTACAAYGAAATGTTTRTTGGAGAACTG[T/A]CGAGTGGACAGGCAGWTTGCTCGATTTGTGCTGCCAGTGGGAGCAACCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link