zgc:114097

Ensembl ID:
ENSDARG00000034616
ZFIN ID:
ZDB-GENE-050913-67
Description:
myeloid leukemia factor 2 [Source:RefSeq peptide;Acc:NP_001020687]
Human Orthologue:
MLF2
Human Description:
myeloid leukemia factor 2 [Source:HGNC Symbol;Acc:7126]
Mouse Orthologue:
Mlf2
Mouse Description:
myeloid leukemia factor 2 Gene [Source:MGI Symbol;Acc:MGI:1353554]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36182 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045210 Essential Splice Site 51 250 2 8

The following transcripts of ENSDARG00000034616 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34050358)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31872842
GRCz11 16 31828430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGTTTGCTCTCACTCCGCAGATCCAGCATCCACGTACACGCATTCAGG[T/C]ACACGTCTGATTAATCTATTTGCATATTATTATGTAGTATTTAAAGGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link