zgc:101614

Ensembl ID:
ENSDARG00000034480
ZFIN ID:
ZDB-GENE-041114-167
Description:
hypothetical protein LOC492811 [Source:RefSeq peptide;Acc:NP_001007453]
Human Orthologue:
GNB4
Human Description:
guanine nucleotide binding protein (G protein), beta polypeptide 4 [Source:HGNC Symbol;Acc:20731]
Mouse Orthologue:
Gnb4
Mouse Description:
guanine nucleotide binding protein (G protein), beta 4 Gene [Source:MGI Symbol;Acc:MGI:104581]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21983 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21984 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045015 Essential Splice Site 166 279 8 10
Genomic Location (Zv9):
Chromosome 11 (position 45349969)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150036.1 2930
GRCz11 11 44244702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGAATTTTTGCTTAAGTTTGCTCATGCGTGTTTGTGTGCATTTGCA[G/A]TGCATTGTGGGACATCGAGACAGGCCAGCAGACCACCAGTTTCACAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21984
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045015 Nonsense 176 279 8 10
Genomic Location (Zv9):
Chromosome 11 (position 45349998)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150036.1 2959
GRCz11 11 44244731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTGTTTGTGTGCATTTGCAGTGCATTGTGGGACATCGAGACAGGCCAG[C/T]AGACCACCAGTTTCACAGGGCACACAGGAGACGTGATGAGTCTGTCGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link