slit3

Ensembl ID:
ENSDARG00000034268
ZFIN ID:
ZDB-GENE-010306-4
Description:
slit homolog 3 protein [Source:RefSeq peptide;Acc:NP_571811]
Human Orthologue:
SLIT3
Human Description:
slit homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:11087]
Mouse Orthologue:
Slit3
Mouse Description:
slit homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1315202]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa202 Nonsense Confirmed mutation in F2 line During 2018
sa1569 Essential Splice Site F2 line generated During 2018
sa35691 Nonsense Mutation detected in F1 DNA During 2018
sa30677 Nonsense Mutation detected in F1 DNA During 2018
sa14755 Nonsense Available for shipment Available now
sa11742 Nonsense Available for shipment Available now
sa9875 Nonsense Available for shipment Available now
sa42392 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa202
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046112 Nonsense 163 1515 6 36
ENSDART00000126199 Nonsense 164 177 6 6
ENSDART00000146299 Nonsense 164 1516 6 36
Genomic Location (Zv9):
Chromosome 14 (position 25601271)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24304362
GRCz11 14 24601607
KASP Assay ID:
554-0151.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGTCTCTCATCTGCAGGCAACTGGACAGCAACCACATCAGCTGCATC[G/T]AAGATGGAGCCTTCCGAGCCCTGCGCGATTTGGAGATACTGTGAGTCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1569
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046112 Essential Splice Site 176 1515 7 36
ENSDART00000126199   None 177 None 6
ENSDART00000146299 Essential Splice Site 177 1516 7 36
Genomic Location (Zv9):
Chromosome 14 (position 25591202)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24294293
GRCz11 14 24591538
KASP Assay ID:
554-1512.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAAAGTGAAACATGCCTTTTTTMTAACGTGTTCTGTCTTCTTTTTTCT[A/G]GCACTCTCAACAACAACAATATCACCCTCATCCCACTGTCAAGCTTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046112 Nonsense 413 1515 13 36
ENSDART00000126199   None 177 None 6
ENSDART00000146299 Nonsense 414 1516 13 36
Genomic Location (Zv9):
Chromosome 14 (position 25567330)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24270421
GRCz11 14 24567666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCTGCTGTCCCTCTATGACAACAAACTTCAGACCATCAGCAAAGGCT[T/A]GTTCGCTCCTCTGCGTGCCATCAAAACCCTGTGAGTTACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046112 Nonsense 768 1515 21 36
ENSDART00000126199   None 177 None 6
ENSDART00000146299 Nonsense 769 1516 21 36
Genomic Location (Zv9):
Chromosome 14 (position 25537865)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24240956
GRCz11 14 24538201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAGGAAACCTCCTCACATCCGTTCCCAAAGAGCTTCCTAATCTGAAA[C/T]AACTGACACTCCTGTATGTATTTTTGCTCTTTTGATTGAATTTATTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046112 Nonsense 1054 1515 30 36
ENSDART00000126199   None 177 None 6
ENSDART00000146299 Nonsense 1055 1516 30 36
Genomic Location (Zv9):
Chromosome 14 (position 25515239)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24218330
GRCz11 14 24515575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTCAAGCCTCTACACTGTGCTTTTGTTGTTTTCTTCAGATRTGAGTG[T/A]TTGCCTGGTTATGTTGGCCAGCAGTGTGAGCAGGATTAMAATGACTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11742
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046112 Nonsense 1067 1515 30 36
ENSDART00000126199   None 177 None 6
ENSDART00000146299 Nonsense 1068 1516 30 36
Genomic Location (Zv9):
Chromosome 14 (position 25515200)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24218291
GRCz11 14 24515536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGTGAGTGWTTGCCTGGTTATGTTGGCCAGCAGTGTGAGCAGGATTA[C/A]AATGACTGTCTGGAGAACAAATGTCAGCATGGGGCAGAGTGTGTTGACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046112 Nonsense 1102 1515 31 36
ENSDART00000126199   None 177 None 6
ENSDART00000146299 Nonsense 1103 1516 31 36
Genomic Location (Zv9):
Chromosome 14 (position 25512675)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24215766
GRCz11 14 24513011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATGTTTAAAAATGTGTCCCTCTCACTTTTYTTAGTGGGCTATTCTGT[G/T]AGAATCATCCACCAATGGTAYTGCTCCAGAACACAAGTCCATGCGATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046112 Essential Splice Site 1367 1515 34 36
ENSDART00000126199   None 177 None 6
ENSDART00000146299 Essential Splice Site 1368 1516 34 36
Genomic Location (Zv9):
Chromosome 14 (position 25497295)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24200386
GRCz11 14 24497631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCCACTATGTGAACAGATGAGCTCCCAAGACCCCTGTGAAAGCAGCAG[G/T]TACACAAACACATACGCACTGGATACTAATGCCTGTCCTGATTTTGCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link