zgc:73061

Ensembl ID:
ENSDARG00000034215
ZFIN ID:
ZDB-GENE-040426-1983
Description:
Ras-related protein Rab-39A [Source:RefSeq peptide;Acc:NP_998207]
Human Orthologues:
RAB42, RAB42P1
Human Descriptions:
RAB42, member RAS oncogene family [Source:HGNC Symbol;Acc:28702]
RAB42, member RAS oncogene family, pseudogene 1 [Source:HGNC Symbol;Acc:19799]
Mouse Orthologue:
Rab42-ps
Mouse Description:
RAB42, member RAS oncogene family, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:2441753]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44911 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046530 Nonsense 135 213 2 2
Genomic Location (Zv9):
Chromosome 19 (position 15467592)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 16131196
GRCz11 19 16035558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCCTGATCGGCCACAAGAGCGACCTGAGCCGCGATCGCAAGGTGACA[C/T]GAGATGAGGCCGAGCAGCTAGCGGCCGATCTCGGAATCCGCTATGTGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link