si:dkey-240h12.4

Ensembl ID:
ENSDARG00000034210
ZFIN ID:
ZDB-GENE-070705-406
Description:
Novel protein similar to vertebrate death-associated protein kinase 2 (DAPK2) [Source:UniProtKB/TrEM
Human Orthologues:
DAPK1, DAPK2, DAPK3
Human Descriptions:
death-associated protein kinase 1 [Source:HGNC Symbol;Acc:2674]
death-associated protein kinase 2 [Source:HGNC Symbol;Acc:2675]
death-associated protein kinase 3 [Source:HGNC Symbol;Acc:2676]
Mouse Orthologues:
Dapk1, Dapk2, Dapk3
Mouse Descriptions:
death associated protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1916885]
death-associated protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1341297]
death-associated protein kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1203520]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18500 Nonsense Available for shipment Available now
sa13765 Essential Splice Site Available for shipment Available now
sa10189 Essential Splice Site Available for shipment Available now
sa23468 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044426 Nonsense 84 371 3 12
ENSDART00000143143   None 269 None 10
Genomic Location (Zv9):
Chromosome 19 (position 11681541)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11273293
GRCz11 19 11191291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGAAGAGTGTGGARAAGGAGGTGGAGATCCTGCAGAGCCTTCAGCAT[C/T]AAAACATCATGGCTATCAGAGACGTCTTCGAGAGCAGGGCAGAGATCKTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044426 Essential Splice Site 105 371 None 12
ENSDART00000143143 Essential Splice Site 13 269 None 10
Genomic Location (Zv9):
Chromosome 19 (position 11681475)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11273227
GRCz11 19 11191225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAGACGTCTTCGAGAGCAGGGCAGAGATCKTCCTCATCGTTGAACTG[T/A]AARCATGTGTTTGCTTTTCTRAAATAAAGAAATATGTAGNAAAAAAANNGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044426 Essential Splice Site 194 371 5 12
ENSDART00000143143 Essential Splice Site 102 269 3 10
Genomic Location (Zv9):
Chromosome 19 (position 11678687)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11270439
GRCz11 19 11188437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCAAGGAGAAGAGTATAAGAGTTTAGGTGGAACCCCTCAGTAKATYG[G/A]TGAGTCGTTCAGTATGTGYGGTTTTGAATTCAAATGATGACKTCACATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044426 Essential Splice Site 211 371 6 12
ENSDART00000143143 Essential Splice Site 119 269 4 10
Genomic Location (Zv9):
Chromosome 19 (position 11668147)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11259899
GRCz11 19 11177897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCCTGAGATCATCAACTATGAACCTCTCGGTACGGCTGCAGACATGTG[G/A]TAAGATTAGTAACAAGCACTCATACCTTAATTCAAATATAGCTATAAGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link