
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mrrf
- Ensembl ID:
- ENSDARG00000034174
- ZFIN ID:
- ZDB-GENE-040704-12
- Description:
- ribosome-recycling factor, mitochondrial [Source:RefSeq peptide;Acc:NP_001002174]
- Human Orthologues:
- MRRF, MRRFP1
- Human Descriptions:
- mitochondrial ribosome recycling factor pseudogene 1 [Source:HGNC Symbol;Acc:35238]
- mitochondrial ribosome recycling factor [Source:HGNC Symbol;Acc:7234]
- Mouse Orthologue:
- Mrrf
- Mouse Description:
- mitochondrial ribosome recycling factor Gene [Source:MGI Symbol;Acc:MGI:1915121]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21672 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21672
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000039536 | Essential Splice Site | 109 | 257 | 5 | 8 |
- Genomic Location (Zv9):
- Chromosome 10 (position 9411874)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 9487830 GRCz11 10 9321389 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATTGCAGCGAATCCTGTTGGCTAACAAAAGATTTTGTTCTTATGTGTTC[A/T]GGTGCACTGGACCACATTACAGTCACCACAAAGGATGGCAAATTTCCTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: