slc4a1ap

Ensembl ID:
ENSDARG00000034160
ZFIN ID:
ZDB-GENE-080521-2
Human Orthologue:
SLC4A1AP
Human Description:
solute carrier family 4 (anion exchanger), member 1, adaptor protein [Source:HGNC Symbol;Acc:13813]
Mouse Orthologue:
Slc4a1ap
Mouse Description:
solute carrier family 4 (anion exchanger), member 1, adaptor protein Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45618 Nonsense Mutation detected in F1 DNA During 2018
sa23155 Nonsense Available for shipment Available now
sa16732 Nonsense Available for shipment Available now
sa36489 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046003 Nonsense 125 768 1 14
Genomic Location (Zv9):
Chromosome 17 (position 41038833)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 40924461
GRCz11 17 40879776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCGAGAGATTAAAGGAACCGAGAGTACAGCCGAAATCAAAAGACATC[A/T]GACCCAAGATCCCTCCGGCTGGTAAATTCCCTCCGCTCCCGTACACCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046003 Nonsense 152 768 1 14
Genomic Location (Zv9):
Chromosome 17 (position 41038916)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 40924544
GRCz11 17 40879859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCTCCCGTACACCGAGCCCCCATGGGGAGCTGTCCCTGACATCAACTA[C/A]TCGTTTGAACTGCTGAAAAATGGAGCTATCCTAGACACCGTCCCGCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046003 Nonsense 424 768 5 14
Genomic Location (Zv9):
Chromosome 17 (position 41046416)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 40932044
GRCz11 17 40887359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAAGAAAGAAGCGGCAGTYCAGTGCTGCCTGGAGGCCTGTCGTATCT[T/A]GGAGGCCCGTGGCCTWTTRAGACAGGAGGCAGGTAGGTKGACRTTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046003 Essential Splice Site 576 768 8 14
Genomic Location (Zv9):
Chromosome 17 (position 41048847)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 40934475
GRCz11 17 40889790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGTGGAGCTGGCTAAACCCACACAGCTGCCTTCATTGCTGTCTAGCGG[G/A]TGAGATCATGAGATCTGTGTTTTCTTTCAAACTTTTCATTCTTTTTTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link