
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rarga
- Ensembl ID:
- ENSDARG00000034117
- ZFIN ID:
- ZDB-GENE-980526-531
- Description:
- Retinoic acid receptor gamma-A [Source:UniProtKB/Swiss-Prot;Acc:Q91392]
- Human Orthologue:
- RARG
- Human Description:
- retinoic acid receptor, gamma [Source:HGNC Symbol;Acc:9866]
- Mouse Orthologue:
- Rarg
- Mouse Description:
- retinoic acid receptor, gamma Gene [Source:MGI Symbol;Acc:MGI:97858]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32460 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32460
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000049551 | Nonsense | 151 | 499 | 4 | 8 |
ENSDART00000103158 | Nonsense | 159 | 507 | 4 | 8 |
ENSDART00000129222 | None | 153 | None | 4 | |
ENSDART00000143935 | None | 153 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 23 (position 36010753)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 35860406 GRCz11 23 35959209 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGGAGTATTGAGCAGCCTCTCTTTGTGACTTTCAGCTGTGCGCAACGAT[C/T]GAAATAAGAAGAAGAAAGACGTGAAGGATGAGGTCATTCCGCCAGAGAGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: