actl6b

Ensembl ID:
ENSDARG00000034107
ZFIN ID:
ZDB-GENE-050522-191
Description:
actin-like 6B [Source:RefSeq peptide;Acc:NP_001018576]
Human Orthologue:
ACTL6B
Human Description:
actin-like 6B [Source:HGNC Symbol;Acc:160]
Mouse Orthologue:
Actl6b
Mouse Description:
actin-like 6B Gene [Source:MGI Symbol;Acc:MGI:1933548]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37795 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114640 Essential Splice Site 204 377 8 14
Genomic Location (Zv9):
Chromosome 23 (position 44595001)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44662450
GRCz11 23 44478970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACAAACTGCCTCCAGTCAGCAAGTCGTGGCACACGTTTATGTGTAAT[G/A]TAAGAGTCCACAACGGTGTGTGTGTGCACGTGTGTGTGTGCACATGTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link