zgc:63546

Ensembl ID:
ENSDARG00000034070
ZFIN ID:
ZDB-GENE-031030-8
Description:
cytochrome P450 CYP2AA3v1 [Source:RefSeq peptide;Acc:NP_001073321]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44050 Nonsense Mutation detected in F1 DNA During 2018
sa31096 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012284 Nonsense 111 496 2 9
Genomic Location (Zv9):
Chromosome 23 (position 42833817)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42517142
GRCz11 23 42482638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGTTCAGGATACTTTTTCTGGGAAGCCATATCTGCCTGTTATAGAGT[G/A]GATATCTAAAGGATTCGGTCAGTAACACTTTACTTATTAAAGCTTCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012284 Essential Splice Site 117 496 2 9
Genomic Location (Zv9):
Chromosome 23 (position 42833798)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42517161
GRCz11 23 42482657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGGAAGCCATATCTGCCTGTTATAGAGTGGATATCTAAAGGATTCGG[T/A]CAGTAACACTTTACTTATTAAAGCTTCCAATTGAAAGATTTCACAGACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link