tax1bp1a

Ensembl ID:
ENSDARG00000034062
ZFIN ID:
ZDB-GENE-060503-587
Description:
Tax1-binding protein 1 homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q1LWB0]
Human Orthologue:
TAX1BP1
Human Description:
Tax1 (human T-cell leukemia virus type I) binding protein 1 [Source:HGNC Symbol;Acc:11575]
Mouse Orthologue:
Tax1bp1
Mouse Description:
Tax1 (human T-cell leukemia virus type I) binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1289308]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36818 Nonsense Available for shipment Available now
sa36817 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36816 Nonsense Available for shipment Available now
sa36815 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104376 Nonsense 254 796 6 16
ENSDART00000138795 Nonsense 244 781 7 17
ENSDART00000143907   None 117 None 3
Genomic Location (Zv9):
Chromosome 19 (position 19046927)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20008231
GRCz11 19 19581182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGTCTAAGAGACAAGTTGCAGAAGGTAATATCTGAAAGGGACAGCTTA[C/T]AAACTCAGCTGAAGAATGAAAGAGACGAAAGGGAGCTTTACAAAGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104376 Essential Splice Site 699 796 15 16
ENSDART00000138795 Essential Splice Site 684 781 16 17
ENSDART00000143907 Essential Splice Site 20 117 2 3
Genomic Location (Zv9):
Chromosome 19 (position 19022269)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19983573
GRCz11 19 19556524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAAGAATAAATGATGTATAGCTTTTATTTAGGTTTTTATGTCTTTCTT[A/C]GGGAGGTGATGGTGAGGCCCCTGCTGTCTGTGAACATCAGAGCCTGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104376 Nonsense 717 796 15 16
ENSDART00000138795 Nonsense 702 781 16 17
ENSDART00000143907 Nonsense 38 117 2 3
Genomic Location (Zv9):
Chromosome 19 (position 19022213)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19983517
GRCz11 19 19556468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATGGTGAGGCCCCTGCTGTCTGTGAACATCAGAGCCTGGAATCTAAT[G/T]AGAGCCACACCAGCTTTTGCTTTGACACCAGGTAAGTGTTTGTAATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104376 Nonsense 773 796 16 16
ENSDART00000138795 Nonsense 758 781 17 17
ENSDART00000143907 Nonsense 94 117 3 3
Genomic Location (Zv9):
Chromosome 19 (position 19017542)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19978846
GRCz11 19 19551797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACTGGAGAGTGTGTCCTGTCTGCAGCGAGCAGTTTCCTCTGGATTGC[C/T]AGCAACAACTCTATGAAAAGCATGTGCACACTCACTTTGATGGCAATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link