si:dkey-260j18.3

Ensembl ID:
ENSDARG00000034058
ZFIN ID:
ZDB-GENE-041010-4
Description:
Novel protein similar to procollagen-proline, 2-oxoglutarate 4-dioxygenase (Proline 4-hydroxylase),
Human Orthologue:
P4HA3
Human Description:
prolyl 4-hydroxylase, alpha polypeptide III [Source:HGNC Symbol;Acc:30135]
Mouse Orthologue:
P4ha3
Mouse Description:
procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III Gen

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35816 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35817 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043434 Essential Splice Site 233 538 4 13
ENSDART00000147233 Essential Splice Site 287 592 4 13
ENSDART00000148284   None 230 None 4
Genomic Location (Zv9):
Chromosome 15 (position 13459517)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14802194
GRCz11 15 14738151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCACGCTTGAAGATGCCCTGGACCATTTGGCTTTCTCTCATTTCAAG[G/A]TATGTCACTAATTACAAAACAAATATGATTTTAACCGAGACCCTGTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043434 Nonsense 299 538 6 13
ENSDART00000147233 Nonsense 353 592 6 13
ENSDART00000148284   None 230 None 4
Genomic Location (Zv9):
Chromosome 15 (position 13481167)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14780544
GRCz11 15 14716501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCCGACGGCATTTATTTGAGAACCAGGAATGCCTATGAACAGCTCTG[C/A]CAAACCAAAGGATCTCAGGTACCATTTCACTTTTATATTTGTTGTACCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link