zgc:92275

Ensembl ID:
ENSDARG00000034048
ZFIN ID:
ZDB-GENE-040718-356
Description:
hypothetical protein LOC436885 [Source:RefSeq peptide;Acc:NP_001002612]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23866 Essential Splice Site Available for shipment Available now
sa1662 Essential Splice Site Available for shipment Available now
sa9014 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049036 Essential Splice Site 143 460 1 7
Genomic Location (Zv9):
Chromosome 21 (position 9839832)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11323195
GRCz11 21 11415823
KASP Assay ID:
2261-5294.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTCTCACATGCTGGAGAGAGGAGATGTGAAGAGTGTGACAGTACTGG[G/A]TAAGTGTAAGAAAACGTCAAGAATTGTAAATAAAACTACGCAGGTGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049036 Essential Splice Site 308 460 4 7
Genomic Location (Zv9):
Chromosome 21 (position 9851887)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11335250
GRCz11 21 11427878
KASP Assay ID:
554-1609.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGCTACACAAACAGCAAGACYTGGGAGTTTATACGGCACGACTGGAAG[G/A]TTTGATTCCTCACACACACACGCACACATCCTTAAGACAAATGGAGCAGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049036 Essential Splice Site 407 460 6 7
Genomic Location (Zv9):
Chromosome 21 (position 9857703)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11341066
GRCz11 21 11433694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCWTCCCTCCGCTCGTACCCAAGTTCATCCTTCGGGCTGAGTGCATCCAG[G/A]TAAATCAGACTGAGATGTGCATATCTAAAATATCGAATTTTGCATTGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link