
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:92275
- Ensembl ID:
- ENSDARG00000034048
- ZFIN ID:
- ZDB-GENE-040718-356
- Description:
- hypothetical protein LOC436885 [Source:RefSeq peptide;Acc:NP_001002612]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23866 | Essential Splice Site | Available for shipment | Available now |
sa1662 | Essential Splice Site | Available for shipment | Available now |
sa9014 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa23866
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000049036 | Essential Splice Site | 143 | 460 | 1 | 7 |
- Genomic Location (Zv9):
- Chromosome 21 (position 9839832)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 11323195 GRCz11 21 11415823 - KASP Assay ID:
- 2261-5294.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGACTCTCACATGCTGGAGAGAGGAGATGTGAAGAGTGTGACAGTACTGG[G/A]TAAGTGTAAGAAAACGTCAAGAATTGTAAATAAAACTACGCAGGTGAGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1662
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000049036 | Essential Splice Site | 308 | 460 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 21 (position 9851887)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 11335250 GRCz11 21 11427878 - KASP Assay ID:
- 554-1609.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCGCTACACAAACAGCAAGACYTGGGAGTTTATACGGCACGACTGGAAG[G/A]TTTGATTCCTCACACACACACGCACACATCCTTAAGACAAATGGAGCAGG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa9014
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000049036 | Essential Splice Site | 407 | 460 | 6 | 7 |
- Genomic Location (Zv9):
- Chromosome 21 (position 9857703)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 11341066 GRCz11 21 11433694 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCWTCCCTCCGCTCGTACCCAAGTTCATCCTTCGGGCTGAGTGCATCCAG[G/A]TAAATCAGACTGAGATGTGCATATCTAAAATATCGAATTTTGCATTGTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: