zgc:66326

Ensembl ID:
ENSDARG00000034013
ZFIN ID:
ZDB-GENE-030131-561
Description:
RGM domain family [Source:RefSeq peptide;Acc:NP_955867]
Human Orthologue:
RGMB
Human Description:
RGM domain family, member B [Source:HGNC Symbol;Acc:26896]
Mouse Orthologue:
Rgmb
Mouse Description:
RGM domain family, member B Gene [Source:MGI Symbol;Acc:MGI:1916049]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44984 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061725 Nonsense 243 415 3 4
ENSDART00000124646 Nonsense 291 479 5 5
ENSDART00000140819 Nonsense 270 458 3 3
Genomic Location (Zv9):
Chromosome 22 (position 19963507)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 19620200
GRCz11 22 19645178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTCAGCGTTCCAGGACGGCACGCGGAGCGGGGGGAAAGGGGAGAGCT[T/A]GTGGATTGTGGAGGGTAGTGGAGGTTTGGGCATACGGCAAGTTAAGATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link