tmco7

Ensembl ID:
ENSDARG00000034001
ZFIN ID:
ZDB-GENE-050419-237
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LUE9]
Human Orthologue:
TMCO7
Human Description:
transmembrane and coiled-coil domains 7 [Source:HGNC Symbol;Acc:25749]
Mouse Orthologue:
Tmco7
Mouse Description:
transmembrane and coiled-coil domains 7 Gene [Source:MGI Symbol;Acc:MGI:2142786]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36615 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042496 Nonsense 21 1065 2 18
ENSDART00000143304 Nonsense 4 1048 1 17
Genomic Location (Zv9):
Chromosome 18 (position 16733314)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17085080
GRCz11 18 17074146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCCAATATACATTTAAAATGTTCTGGCACACATTCTAGATGGGCAGT[T/A]GAGCGATGGTCAAACCACAGAAGCAGCGCTGCTTTCAGCCCTCCAGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link