
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cyp26a1
- Ensembl ID:
- ENSDARG00000033999
- ZFIN ID:
- ZDB-GENE-990415-44
- Description:
- Cytochrome P450 26A1 [Source:UniProtKB/Swiss-Prot;Acc:P79739]
- Human Orthologue:
- CYP26A1
- Human Description:
- cytochrome P450, family 26, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2603]
- Mouse Orthologue:
- Cyp26a1
- Mouse Description:
- cytochrome P450, family 26, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1096359]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1738 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1738
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041728 | Nonsense | 218 | 492 | 3 | 7 |
The following transcripts of ENSDARG00000033999 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 9711087)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 8919042 GRCz11 12 8956885 - KASP Assay ID:
- 554-1683.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACGGACGAGCAAGAACTGGTGGAAGCTTTTGAGGAAATGATCAAAAACT[T/A]GTTCTCCTTGCCAATCGAYGTTCCTTTCAGTGGTCTGTACAGGGTGAGTT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
- Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: