zgc:85700

Ensembl ID:
ENSDARG00000033987
ZFIN ID:
ZDB-GENE-040426-2374
Description:
hypothetical protein LOC405883 [Source:RefSeq peptide;Acc:NP_998112]
Human Orthologue:
RSRC1
Human Description:
arginine/serine-rich coiled-coil 1 [Source:HGNC Symbol;Acc:24152]
Mouse Orthologue:
Rsrc1
Mouse Description:
arginine/serine-rich coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1914130]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22574 Nonsense Available for shipment Available now
sa28391 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049890 Nonsense 84 308 2 9
ENSDART00000147710 Nonsense 84 186 3 6
Genomic Location (Zv9):
Chromosome 15 (position 2188746)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 2235868
GRCz11 15 2199440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCAGAGGATCCGGTCACAGGAGGCGAAGCCGAAGCGCAGATAGAGGA[C/T]GAAGCCATCGCTCCCACAGATCCCGATCCCGCAGCCGAAACAGGAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049890 Nonsense 110 308 3 9
ENSDART00000147710 Nonsense 110 186 4 6
Genomic Location (Zv9):
Chromosome 15 (position 2225159)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 2272281
GRCz11 15 2235853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGTGTTTCCTAAAGGTCTCGATCCCGCCACCGAAGGTCTCGCAGTTG[C/A]AGCAGTGGACGATCCAGCAGGAAACGCAGCAGAGAGCGAGACCGTGGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link