zgc:101657

Ensembl ID:
ENSDARG00000033957
ZFIN ID:
ZDB-GENE-041010-189
Description:
tRNA (uracil-O(2)-)-methyltransferase-like [Source:RefSeq peptide;Acc:NP_001006086]
Human Orthologue:
C4orf23
Human Description:
chromosome 4 open reading frame 23 [Source:HGNC Symbol;Acc:26653]
Mouse Orthologue:
2310079F23Rik
Mouse Description:
RIKEN cDNA 2310079F23 gene Gene [Source:MGI Symbol;Acc:MGI:1926140]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41055 Nonsense Mutation detected in F1 DNA During 2018
sa44677 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039535 Nonsense 167 340 3 7
ENSDART00000125570 Nonsense 109 574 3 12
ENSDART00000132044 Nonsense 167 625 3 11
Genomic Location (Zv9):
Chromosome 7 (position 60160656)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59379621
GRCz11 7 59684858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCTGAGCAATGGTACAGTGATGGAATAGCTTATCCTAAACTGTCTTG[G/A]CTTCGTACTGAACTTCTACCTAAACTGTCCCGGTGGTCTCTAGAGAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039535   None 340 None 7
ENSDART00000125570 Nonsense 282 574 8 12
ENSDART00000132044 Nonsense 340 625 8 11
Genomic Location (Zv9):
Chromosome 7 (position 60181241)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59400206
GRCz11 7 59705443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCGTCTATAATAGTCTTATTTTATTCTTTTTAGGTCATCTTACTCGTG[C/A]CGTTTCTTTGTGCTTCCTTGCTGCTTTTTTGACTTTTGTGGAAAGTACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link