Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:101657
- Ensembl ID:
- ENSDARG00000033957
- ZFIN ID:
- ZDB-GENE-041010-189
- Description:
- tRNA (uracil-O(2)-)-methyltransferase-like [Source:RefSeq peptide;Acc:NP_001006086]
- Human Orthologue:
- C4orf23
- Human Description:
- chromosome 4 open reading frame 23 [Source:HGNC Symbol;Acc:26653]
- Mouse Orthologue:
- 2310079F23Rik
- Mouse Description:
- RIKEN cDNA 2310079F23 gene Gene [Source:MGI Symbol;Acc:MGI:1926140]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa41055 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa44677 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa41055
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000039535 | Nonsense | 167 | 340 | 3 | 7 |
| ENSDART00000125570 | Nonsense | 109 | 574 | 3 | 12 |
| ENSDART00000132044 | Nonsense | 167 | 625 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 60160656)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 59379621 GRCz11 7 59684858 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGACCTGAGCAATGGTACAGTGATGGAATAGCTTATCCTAAACTGTCTTG[G/A]CTTCGTACTGAACTTCTACCTAAACTGTCCCGGTGGTCTCTAGAGAGCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44677
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000039535 | None | 340 | None | 7 | |
| ENSDART00000125570 | Nonsense | 282 | 574 | 8 | 12 |
| ENSDART00000132044 | Nonsense | 340 | 625 | 8 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 60181241)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 59400206 GRCz11 7 59705443 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTCGTCTATAATAGTCTTATTTTATTCTTTTTAGGTCATCTTACTCGTG[C/A]CGTTTCTTTGTGCTTCCTTGCTGCTTTTTTGACTTTTGTGGAAAGTACCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Response to antineoplastic agents: Association between single nucleotide polymorphism-genotype and outcome of patients with chronic lymphocytic leukemia in a randomized chemotherapy trial. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
