zgc:63948

Ensembl ID:
ENSDARG00000033928
ZFIN ID:
ZDB-GENE-040426-2662
Description:
NEDD4 family-interacting protein 2 [Source:RefSeq peptide;Acc:NP_998512]
Human Orthologue:
NDFIP2
Human Description:
Nedd4 family interacting protein 2 [Source:HGNC Symbol;Acc:18537]
Mouse Orthologue:
Ndfip2
Mouse Description:
Nedd4 family interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1923523]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15053 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103724 Essential Splice Site 140 237 4 8
ENSDART00000132595   None 114 None 3
Genomic Location (Zv9):
Chromosome 1 (position 4258542)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 4671583
GRCz11 1 5369388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCAGCTGAGAGTGGGAAATGATGGGATCTTTATGCTGGCCTTYTTCAG[T/A]AAGTCATGTATACTCTTTATGGGTCAAAGACCGGCATCAANNNNNTGTAGTATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link