si:ch211-243j20.2

Ensembl ID:
ENSDARG00000033916
ZFIN ID:
ZDB-GENE-041014-345
Description:
Uridine kinase [Source:UniProtKB/TrEMBL;Acc:Q5TZ52]
Human Orthologue:
UCKL1
Human Description:
uridine-cytidine kinase 1-like 1 [Source:HGNC Symbol;Acc:15938]
Mouse Orthologue:
Uckl1
Mouse Description:
uridine-cytidine kinase 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1915806]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45714 Nonsense Mutation detected in F1 DNA During 2018
sa1006 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045850 Nonsense 42 541 2 15
ENSDART00000144521 Nonsense 38 540 2 15
Genomic Location (Zv9):
Chromosome 20 (position 38650542)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38722954
GRCz11 20 38625833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTATTTTGTGGCAGTGGTGAGGATTCCCTTGATGGCCTTTTGAGAAAC[C/T]GATGTCCCCTCACCCCTTCAATTTCCCCTCGAAAACGGACCACCAGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045850 Essential Splice Site 428 541 12 15
ENSDART00000144521 Essential Splice Site 427 540 12 15
Genomic Location (Zv9):
Chromosome 20 (position 38687452)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38759864
GRCz11 20 38662743
KASP Assay ID:
554-0910.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGGGAAAGATCCTCATCCAGACCAATCATGACACAGGAGAGCCTGAG[G/A]TTTCACATCTTCCCCACACAYATTTATAAACAAACCCTGATCAGAAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link