
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sepsecs
- Ensembl ID:
- ENSDARG00000033861
- ZFIN ID:
- ZDB-GENE-040426-859
- Description:
- O-phosphoseryl-tRNA(Sec) selenium transferase [Source:UniProtKB/Swiss-Prot;Acc:Q803A7]
- Human Orthologue:
- SEPSECS
- Human Description:
- Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase [Source:HGNC Symbol;Acc:30605]
- Mouse Orthologue:
- Sepsecs
- Mouse Description:
- Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase Gene [Source:MGI Symbol;Acc:MGI:109879
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34255 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa16396 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa34255
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000042492 | Essential Splice Site | 90 | 490 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 75140050)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 71210927 GRCz11 7 71452068 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAAAGCAACTGAGAAAAGCTGTAAATAAATTCTCTGCTAATATCTCCTC[A/G]GGCTGATCCATGGCATCGGTCGGTCGGGTGACATCGCAGCTGTTCAGCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16396
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000042492 | Nonsense | 164 | 490 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 75138740)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 71209617 GRCz11 7 71450758 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCACGCTGTGTTTCCTCACGCTCAGACACAGGAGACCAAAAGCAYGTTA[T/G]ATTCTCTGGCCTCGCATTGACCAGAAGTCCTGTTTCAAGTCTATGGTGAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: