zgc:101121

Ensembl ID:
ENSDARG00000033811
ZFIN ID:
ZDB-GENE-030131-8405
Description:
AN1-type zinc finger protein 6 [Source:RefSeq peptide;Acc:NP_991323]
Human Orthologues:
ZFAND5, ZFAND6
Human Descriptions:
zinc finger, AN1-type domain 5 [Source:HGNC Symbol;Acc:13008]
zinc finger, AN1-type domain 6 [Source:HGNC Symbol;Acc:30164]
Mouse Orthologues:
Zfand5, Zfand6
Mouse Descriptions:
zinc finger, AN1-type domain 5 Gene [Source:MGI Symbol;Acc:MGI:1278334]
zinc finger, AN1-type domain 6 Gene [Source:MGI Symbol;Acc:MGI:1929510]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26892 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14322 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062263 Essential Splice Site None 232 1 7
Genomic Location (Zv9):
Chromosome 7 (position 11466185)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 10320191
GRCz11 7 10562298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTATTAACCCCATTTGAAATCGATATATCCATCTTCGGGAGTCAGGAG[G/A]TGAGTTTATAACGTTTGCCGCCGCCGCCGCTATGAACTGAGTCAGTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062263 Nonsense 67 232 3 7
Genomic Location (Zv9):
Chromosome 7 (position 11453153)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 10333223
GRCz11 7 10575330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCAGCTTAAGCAGTAAAGGAGAATCTCTGACTGTACAATCGAYGTCA[C/T]AGCATGAACAAAACAGGTACAACGTCTTCCTCTTTAATACCCACCCCTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link