si:dkeyp-68f9.9

Ensembl ID:
ENSDARG00000033802
ZFIN ID:
ZDB-GENE-081104-519
Description:
LOC402831 protein [Source:UniProtKB/TrEMBL;Acc:Q7SXE6]
Human Orthologue:
CYP27A1
Human Description:
cytochrome P450, family 27, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2605]
Mouse Orthologue:
Cyp27a1
Mouse Description:
cytochrome P450, family 27, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88594]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18959 Nonsense Mutation detected in F1 DNA During 2018
sa9857 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045588 Nonsense 263 531 4 9
ENSDART00000100483 Nonsense 172 248 3 8
ENSDART00000045588 Nonsense 263 531 4 9
ENSDART00000100483 Nonsense 172 248 3 8

The following transcripts of ENSDARG00000033802 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39465294)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38603190
GRCz11 9 38412985
KASP Assay ID:
2260-2203.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGCACAGATGCTCACCTACAGCATGCCCGTGGTGTTTATGCCCAACT[G/A]GACCCGCAATTACTTGCCATTCTGGCAAAGGTACATTGGCGGCTGGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9857
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045588 Nonsense 263 531 4 9
ENSDART00000100483 Nonsense 172 248 3 8
ENSDART00000045588 Nonsense 263 531 4 9
ENSDART00000100483 Nonsense 172 248 3 8

The following transcripts of ENSDARG00000033802 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39465294)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38603190
GRCz11 9 38412985
KASP Assay ID:
2260-2203.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGCACAGATGCTCACCTACAGCATGCCCGTGGTGTTTATGCCCAACT[G/A]GACCCGCAATTACTTGCCATTCYGGCAAAGGTACATTGGCGGCTGGGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link