zgc:73187

Ensembl ID:
ENSDARG00000033768
ZFIN ID:
ZDB-GENE-030131-9775
Description:
UPF0533 protein C5orf44 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6PBY7]
Human Orthologue:
C5orf44
Human Description:
chromosome 5 open reading frame 44 [Source:HGNC Symbol;Acc:25828]
Mouse Orthologue:
2410002O22Rik
Mouse Description:
RIKEN cDNA 2410002O22 gene Gene [Source:MGI Symbol;Acc:MGI:1914225]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6163 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046274 Essential Splice Site 100 412 4 12
Genomic Location (Zv9):
Chromosome 10 (position 15380063)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15393370
GRCz11 10 15351489
KASP Assay ID:
554-4653.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGTGCACAACGACAGCAGTCAAGTGGTCAAAGACATCCTGGTGAAGG[T/C]AATGGCTCGTCACTACTGACTGAATATCGCATGTGTTTCAGYTTCACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link