silvb

Ensembl ID:
ENSDARG00000033760
ZFIN ID:
ZDB-GENE-050912-2
Description:
melanocyte protein Pmel 17 [Source:RefSeq peptide;Acc:NP_001029090]
Human Orthologue:
SILV
Human Description:
silver homolog (mouse) [Source:HGNC Symbol;Acc:10880]
Mouse Orthologue:
Si
Mouse Description:
silver Gene [Source:MGI Symbol;Acc:MGI:98301]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17924 Essential Splice Site Available for shipment Available now
sa6748 Essential Splice Site Mutation detected in F1 DNA During 2018
sa799 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17924
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046268 Essential Splice Site 18 616 1 12
ENSDART00000132320   None 217 None 5
Genomic Location (Zv9):
Chromosome 23 (position 35724175)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35573828
GRCz11 23 35672631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTATTCTCTACAATATTCATATTATCCAGTTTGTCCGGGGSATTAACAA[G/A]KAAGTAAACACTGTTTCCTTATTATTTWTATAGGTGNNTATTAGATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046268 Essential Splice Site 19 616 1 12
ENSDART00000132320   None 217 None 5
Genomic Location (Zv9):
Chromosome 23 (position 35724176)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35573829
GRCz11 23 35672632
KASP Assay ID:
554-5355.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTCTCTACAATATTCATATTATCCAGTTTGTCCGGGGSATTAACAAG[T/G]AAGTAAACACTGTTTCCTTATTATTTWTATAGGTGTATATTAGATTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046268 Essential Splice Site 150 616 4 12
ENSDART00000132320   None 217 None 5
Genomic Location (Zv9):
Chromosome 23 (position 35728939)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35578592
GRCz11 23 35677395
KASP Assay ID:
554-0704.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACAGGGAGACAAGCCACCTCCATATGTGTTTGTATGGAAAACCTGGGG[T/C]AAGGAAAGCAACTGCTRTACTGCAAGGTGCACTTTTACACCTGGTGTATT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link