
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nt5c1bb
- Ensembl ID:
- ENSDARG00000033742
- ZFIN ID:
- ZDB-GENE-030131-7205
- Description:
- Novel protein similar to vertebrate cytosolic 5'-nucleotidase IB (NT5C1B) [Source:UniProtKB/TrEMBL;A
- Human Orthologue:
- NT5C1A
- Human Description:
- 5'-nucleotidase, cytosolic IA [Source:HGNC Symbol;Acc:17819]
- Mouse Orthologue:
- Nt5c1a
- Mouse Description:
- 5'-nucleotidase, cytosolic IA Gene [Source:MGI Symbol;Acc:MGI:2155700]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa3053 | Nonsense | F2 line generated | During 2018 |
sa36980 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa23641 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa3053
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000039966 | Nonsense | 146 | 364 | 4 | 6 |
ENSDART00000148017 | Nonsense | 116 | 334 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 9462906)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 9297175 GRCz11 20 9284914 - KASP Assay ID:
- 554-2584.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAATATGGTGYTAATAGAAAGATTCTCTTCTTCCAGATCTGACCATAGAG[C/T]GATTCTGCATGACTGGAGGTCAGAGTCCCATCGGCTACCTCAAAGCCTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36980
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000039966 | Nonsense | 214 | 364 | 5 | 6 |
ENSDART00000148017 | Nonsense | 184 | 334 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 9469040)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 9303309 GRCz11 20 9291048 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCAGAGACACAGCTGCGTGTCGCATTTGATGGAGACGCTGTGCTCTTCT[C/A]GGATGAGTCTGAGATCATAGTGAAACAGCACGGCCTGGACACCTTCTTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23641
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000039966 | Nonsense | 246 | 364 | 6 | 6 |
ENSDART00000148017 | Nonsense | 216 | 334 | 6 | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 9478576)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 9312845 GRCz11 20 9300584 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAATAGATCTTCAGACTCAATGCATCCCTTTATATTTCTTCAGGGTCCTT[T/A]AAAATGCTTCCTGGAGGCTCTCGGGAAGCTCCAGAAGAAATTCTATGCCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Amyotrophic lateral sclerosis: Reduced expression of the Kinesin-Associated Protein 3 (KIFAP3) gene increases survival in sporadic amyotrophic lateral sclerosis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: