
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ntn1a
- Ensembl ID:
- ENSDARG00000033733
- ZFIN ID:
- ZDB-GENE-990415-169
- Description:
- netrin 1a [Source:RefSeq peptide;Acc:NP_571104]
- Human Orthologue:
- NTN1
- Human Description:
- netrin 1 [Source:HGNC Symbol;Acc:8029]
- Mouse Orthologue:
- Ntn1
- Mouse Description:
- netrin 1 Gene [Source:MGI Symbol;Acc:MGI:105088]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14131 | Nonsense | Available for shipment | Available now |
sa12269 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14131
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027806 | Nonsense | 286 | 603 | 1 | 7 |
- Genomic Location (Zv9):
- Chromosome 6 (position 18000182)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 23454100 GRCz11 6 19925421 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCMTATTTTTACGCAGTTTCCGACCTGCAGRTTGGAGGCAGATGTAAGTG[T/A]AATGGACACGCATCACGGTGCGTCAAAGACCGGGATGGAAACCTAGTGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12269
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027806 | Nonsense | 415 | 603 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 6 (position 18096503)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 23357779 GRCz11 6 19829100 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCCTCGCAGCCTGTGATTGCCATYCTGTGGGGGCCGCGGGCAAAACCTG[T/A]AACCAAACCACAGGCCAATGCCCCTGTAAAGACGGTGTGACGGGTATCAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Breast cancer (prognosis): Identification of inherited genetic variations influencing prognosis in early-onset breast cancer. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: