zgc:100906

Ensembl ID:
ENSDARG00000033599
ZFIN ID:
ZDB-GENE-040801-20
Description:
protein disulfide-isomerase A3 [Source:RefSeq peptide;Acc:NP_001003517]
Human Orthologue:
PDIA3
Human Description:
protein disulfide isomerase family A, member 3 [Source:HGNC Symbol;Acc:4606]
Mouse Orthologue:
Pdia3
Mouse Description:
protein disulfide isomerase associated 3 Gene [Source:MGI Symbol;Acc:MGI:95834]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10258 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049020 Essential Splice Site 154 493 4 13
ENSDART00000134455 Essential Splice Site 155 494 4 13
Genomic Location (Zv9):
Chromosome 19 (position 27206719)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27136831
GRCz11 19 26721054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCTTGATCTGGAGAAATTCATCAATCATTTTGATGCCAGTGTAGTTG[G/A]TAAATACATTTTAATGGTTGTATATWTTGTCTATTGTTTATGCTATARGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link